algorithms nis elements ar software nikon version 4 30 02 image lab software bio rad version 6 1 0 other nikon eclipse ti (Bio-Rad)
Bio-Rad is a verified supplier 
Bio-Rad manufactures this product 
99
Structured Review
Bio-Rad
algorithms nis elements ar software nikon version 4 30 02 image lab software bio rad version 6 1 0 other nikon eclipse ti
Algorithms Nis Elements Ar Software Nikon Version 4 30 02 Image Lab Software Bio Rad Version 6 1 0 Other Nikon Eclipse Ti, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 35689 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+and+algorithms/Image+Lab+Software/pm42867999-77-55-65
Average 99 stars, based on 35689 article reviews
Algorithms Nis Elements Ar Software Nikon Version 4 30 02 Image Lab Software Bio Rad Version 6 1 0 Other Nikon Eclipse Ti, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 35689 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/software+and+algorithms/Image+Lab+Software/pm42867999-77-55-65
Average 99 stars, based on 35689 article reviews
algorithms nis elements ar software nikon version 4 30 02 image lab software bio rad version 6 1 0 other nikon eclipse ti - by Bioz Stars,
2026-10
99/100 stars
Images
Related Articles
Software:Article Title: Protocol for quantifying mitotic progression in adherent and suspension cells by live-cell imaging. Article Snippet: .. Fetal bovine serum (FBS) Saveen & Werner FB-1090–500 Trypsin + EDTA Gibco 3624-01 SPY-DNA Spirochrome SPY-505-DNA SPY-Tubulin Spirochrome SPY-555-tubulin Thymidine Sigma-Aldrich T1895 PBS without Ca2+ and Mg2+ SVA, Uppsala 992420/1000 Fibronectin (FN) Sigma-Aldrich F0895 Poly-L-lysine (PLL) Sigma-Aldrich P9155 Penicillin/Streptomycin Gibco 10378016 Experimental models: Cell lines hTERT-immortalized BJ fibroblasts Ludwig Institute, Uppsala RRID: CVCL_3653 Software and Article Title: Cellular self-organization orchestrates ferroptosis propagation. Article Snippet: 30632780 Experimental models: Cell lines Human: hTERT-RPE1 cells ATCC CRL-4000; RRID: CVCL_4388 (Continued on next page) ll OPEN ACCESS e1 Cell 189, 1–17.e1–e12, December 24, 2026 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: HEK293T cells ATCC CRL-3216; RRID: CVCL_0063 Oligonucleotides Control siRNA Dharmacon Cat# D-001810-01 ON-TARGETplus SMARTpool siRNAs targeting SLC7A11/xCT Dharmacon Cat# L2-007612-01 ON-TARGETplus SMARTpool siRNAs targeting GPX4 Dharmacon Cat# L2-011676-01 Primer: SLC7A11/xCT Forward: 5′-ATGCAGTGGCAGTGACCTTT-3′ Genomics, Taiwan This paper Primer: SLC7A11/xCT Reverse: 5′-GGCAACAAAGATCGGAACTG-3′ Genomics, Taiwan This paper Primer: GPX4 Forward: 5′-GTGAGGCAAGACCGAAGTAAA-3′ Genomics, Taiwan This paper Primer: GPX4 Reverse: 5′-GAACTGGTTACACGGGAAGG-3′ Genomics, Taiwan This paper Primer: β-actin Forward: 5′-CACCATTGGCAATGAGCGGTTC-3′ Genomics, Taiwan This paper Primer: β-actin Reverse: 5′-AGGTCTTTGCGGATGTCCACGT-3′ Genomics, Taiwan This paper Recombinant DNA Plasmid: pCMV-VSV-G Addgene RRID: Addgene_8454 Plasmid: psPAX2 Addgene RRID: Addgene_12260 Plasmid: pLVX-mCherry-C1 Takara Bio Cat# 632561 Plasmid: pRRL-hCMV-SoNar This paper Zhao et al.45 Software and algorithms Article Title: Incorporation of genome-bound cellular proteins into HIV-1 particles regulates viral infection. Article Snippet: .. AACAATA – N/A Primers for cloning, sgRNAs and knock out validation This paper See Table S6 Recombinant DNA pNL4-3 NIBSC – Center for AIDS Reagents Cat#2006 pNL4-3.Luc.R-E− NIBSC – Center for AIDS Reagents Cat#2128 pNL4.3-mCherry-T2A-Nef This paper N/A pNL4-3.R-E-mCherry-T2A-Nef Garcia-Moreno et al.62 N/A pNL4-3.R-E-mCherry-T2A-Nef-RevFlag-3xMyc This paper N/A pNL4-3.R-E-mCherry-T2A-Nef -Rev-Halo This paper N/A pNL4-3.R-E-mCherry-T2A-Nef-ΔRev This paper N/A pNL4.3-mCherry-T2A-gag Garcia-Moreno et al.62 N/A psPAX-2 Addgene Cat#12260 pHEF-VSVG NIH AIDS Reagent Program Cat#4693 pcR-Blunt vector Thermo Fisher Scientific Cat#K270020 pcR-Blunt-NL4.3-mCherry-T2A-Nef This paper N/A pcDNA6/TR plasmid Thermo Fisher Scientific Cat#V102520 pOG44 Thermo Fisher Scientific Cat#V600520 pcDNA5/FRT/TO-EGFP Castello et al.63 N/A pcDNA5/FRT/TO-EGFP-linker Garcia-Moreno et al.62 N/A MGC Human PURA Sequence-Verified cDNA (CloneId:5284976) Horizon Cat#MHS6278-202808724 BLADE plasmid Mageot et al.64 N/A Software and Article Title: Ubiquitination-directed cytosolic DNA degradation governs cGAS-STING-mediated immune response to DNA damage. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER plenti-hygro-GFP-SPOP This paper N/A lentiCRISPR v2 Addgene Cat# 52961 pLVX-IRES-Neo Clontech Cat# 632181 psPAX2 Addgene Cat# 12260 pMD2.G Addgene Cat# 12259 Software and Article Title: Rad53 regulates RNase H1, which promotes DNA replication through sites of transcription-replication conflict. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PhosSTOP Roche Cat#04906845001 Proteinase K BioFroxx Cat#1151ML010 Q5 HotStart High-Fidelity DNA Polymerase New England Biolabs Cat#M0493L QX200TM ddPCRTM EvaGreen Supermix Bio-Rad Cat#186-4033 Random hexamers Thermo Fisher Scientific Cat#SO142 RNase A Thermo Fisher Scientific Cat#EN0531 RNase H New England Biolabs Cat#M0297L RNase T1 Thermo Fisher Scientific Cat#EN0542 RNaseOutTM Invitrogen Cat#10777019 SuperfrostTMPlus Adhesion Microscope Slides Epredia Cat#10149870 SuperScriptTM III Reverse Transcriptase Invitrogen Cat#18080044 SuperSignalTM West FEMTO Chemiluminescent Substrate Thermo Fisher Scientific Cat#34094 SuperSignalTM West Pico PLUS chemiluminescent substrate Thermo Fisher Scientific Cat#15669364 SYTOX Green nucleic acid stain Thermo Fisher Scientific Cat#S7020 Zymolyase® 20T (Arthrobacter luteus) Amsbio Cat#120491-1 Critical commercial assays Gentra Puregene Yeast/Bact. .. Extraction Kit B Qiagen Cat#158567 QIAquick PCR purification kit Qiagen Cat#28106 riboPool kit siTOOLs Cat#dp-P024-5 RNasre-Free DNase Set Qiagen Cat#79254 TruSeq stranded Total RNA LT Sample Prep Kit Illumina Cat#20020598 Deposited data RNA sequencing This study SRA: PRJNA1212884 Experimental models: Organisms/strains S. cerevisiae strains, S288C background derivatives This study See Table S1 Oligonucleotides Primers This study See Table S2 Software and Article Title: An mTOR-Stat3-Stathmin pathway controls centrosome and microtubule dynamics for oocyte polarization. Article Snippet: KASP-PCR was performed on an Applied Biosystems StepOnePlus machine and following the manufacturer instructions, using the following SNP sequence: ATGCATGTTATAACAATCTGAAAACTGAAAATACTAAAACTGAAACTAATATTTAGCTATTGCTTGGGTATAACCTCTTACTCATC CTCCACAGGACA[TGGAGCA/-]GAAGATGAAAATGTTGGA GAATCTGCAGGATGATTTTGATTTCAACTACAAAACTCTTAAGAGTG CTGGA .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primer: Stathmin Forward: CAAGCCTGGAAC TCTCTGAAG; Reverse: CTGGATCTCCACCA AGGAAAG; Ddx4 Forward 5 ′ -GGTCGTGGA AAGATTGGCCTG-3 ′ ,Ddx4 Reverse 5 ′ -CAGCAGC CATTCTTTGAATATCTTC-3 ′ ; Beta actin Forward: 5 ′ -GGATTCGCTGGAGATGATGC; Reverse: 5 ′ – CGTGCTCGATGGGGTACTTC; HCR Probes: foxl2l; rec8a; dmc1 This paper; Molecular Instruments; Molecular Instruments; Molecular Instruments N/A; (accession #NM_001128810.1); (accession # XM_017359108.1); (#NM_001020782.1) KASP primer: stat3 stl27 Genotyping SNP primer sequence: ATGCATGTTATAACAATCTGAAAACTGAAAATACTAA AACTGAAACTAATATTTAGCTATTGCTTGGGTATAAC CTCTTACTCATCCTCCACAGGACA[TGGAGCA/-] GAAGATGAAAATGTTGGAGAATCTGCAGGATGATTTT GATTTCAACTACAAAACTCTTAAGAGTGCTGGA Kbioscience; This Paper N/A Software and Article Title: 5-HT promotes bronchopulmonary dysplasia via TGM2-mediated serotonylation Article Snippet: .. 340 STAR METHODS 341 KEY RESOURCES TABLE 342 REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti- Serotonin Abcam Cat# Ab315150; RRID: AB_3697404 Anti-Transglutaminase 2 Cell Signaling Technology Cat# 3557; RRID: AB_2202883 Anti-Ki67 Rabbit pAb Servicebio Cat# GB111499 RRID: AB_2927572 Anti- β-Actin Proteintech Cat# 81115-1-RR; RRID: AB_2923704 Goat Anti-Rabbit IgG (H+L) Earthox Cat# E031620 RRID: AB_3065690 Goat Anti-Mouse IgG (H + L) HRP MultiSciences Cat# GAM0072 RRID: AB_3065690 Goat Anti-Rabbit IgG (H + L) HRP MultiSciences Cat# GAR007 RRID: AB_3073716 Biological samples Preterm infant blood samples Children’s Hospital of Nanjing Medical University Ethics No: 202110094-1 Chemicals, peptides, and recombinant proteins Jo urn al Pr e-p roo f 5-HT MCE Cat# HY-B1473A 5-PT MCE Cat# HY-156562 LB-533401 MCE Cat# HY-15849 ZED-1227 TargetMol Cat# T17289 DMEM/F12 Gibco Cat# 11320033 FBS Gibco Cat# 10099141C penicillin‒streptomycin Gibco Cat# 15070063 RIPA Beyotime Cat# P0013B Protease inhibitor cocktail and phosphatase inhibitor Beyotime Cat# P1046 SBE-β-CD MCE Cat# HY-17031 DMSO Beyotime Cat# ST038 PEG300 Beyotime Cat# Y268724 Tween 80 Beyotime Cat# ST2789 biotin-azide Thermo Fisher Cat# B10184 magnetic streptavidin beads MCE Cat# HY-K0208 Critical commercial assays Click-iT Cell Reaction Buffer Kit Thermo Fisher Cat# C33372 TGM2 Activity Assay Kit Novus Biologicals Cat# NBP1-37008 5-HT ELISA Kit Elabscience Cat# E-EL-0033 Cell Counting Kit-8 Beyotime Cat# C0038 Annexin V-FITC Apoptosis Detection Kit Beyotime Cat# C1062M TUNEL Cell Apoptosis Detection Kit Servicebio G1507-50T Experimental models: Cell lines MLE-12 ATCC BH-C465 Experimental models: Organisms/strains Lung of C57BL/6 wild-type mice Animal Center of Nanjing Medical University N/A Software and Inverted Microscopy:Article Title: Protocol for quantifying mitotic progression in adherent and suspension cells by live-cell imaging. Article Snippet: .. Fetal bovine serum (FBS) Saveen & Werner FB-1090–500 Trypsin + EDTA Gibco 3624-01 SPY-DNA Spirochrome SPY-505-DNA SPY-Tubulin Spirochrome SPY-555-tubulin Thymidine Sigma-Aldrich T1895 PBS without Ca2+ and Mg2+ SVA, Uppsala 992420/1000 Fibronectin (FN) Sigma-Aldrich F0895 Poly-L-lysine (PLL) Sigma-Aldrich P9155 Penicillin/Streptomycin Gibco 10378016 Experimental models: Cell lines hTERT-immortalized BJ fibroblasts Ludwig Institute, Uppsala RRID: CVCL_3653 Software and Fluorescence:Article Title: Protocol for quantifying mitotic progression in adherent and suspension cells by live-cell imaging. Article Snippet: .. Fetal bovine serum (FBS) Saveen & Werner FB-1090–500 Trypsin + EDTA Gibco 3624-01 SPY-DNA Spirochrome SPY-505-DNA SPY-Tubulin Spirochrome SPY-555-tubulin Thymidine Sigma-Aldrich T1895 PBS without Ca2+ and Mg2+ SVA, Uppsala 992420/1000 Fibronectin (FN) Sigma-Aldrich F0895 Poly-L-lysine (PLL) Sigma-Aldrich P9155 Penicillin/Streptomycin Gibco 10378016 Experimental models: Cell lines hTERT-immortalized BJ fibroblasts Ludwig Institute, Uppsala RRID: CVCL_3653 Software and Tissue:Article Title: Protocol for quantifying mitotic progression in adherent and suspension cells by live-cell imaging. Article Snippet: .. Fetal bovine serum (FBS) Saveen & Werner FB-1090–500 Trypsin + EDTA Gibco 3624-01 SPY-DNA Spirochrome SPY-505-DNA SPY-Tubulin Spirochrome SPY-555-tubulin Thymidine Sigma-Aldrich T1895 PBS without Ca2+ and Mg2+ SVA, Uppsala 992420/1000 Fibronectin (FN) Sigma-Aldrich F0895 Poly-L-lysine (PLL) Sigma-Aldrich P9155 Penicillin/Streptomycin Gibco 10378016 Experimental models: Cell lines hTERT-immortalized BJ fibroblasts Ludwig Institute, Uppsala RRID: CVCL_3653 Software and Suspension:Article Title: Protocol for quantifying mitotic progression in adherent and suspension cells by live-cell imaging. Article Snippet: .. Fetal bovine serum (FBS) Saveen & Werner FB-1090–500 Trypsin + EDTA Gibco 3624-01 SPY-DNA Spirochrome SPY-505-DNA SPY-Tubulin Spirochrome SPY-555-tubulin Thymidine Sigma-Aldrich T1895 PBS without Ca2+ and Mg2+ SVA, Uppsala 992420/1000 Fibronectin (FN) Sigma-Aldrich F0895 Poly-L-lysine (PLL) Sigma-Aldrich P9155 Penicillin/Streptomycin Gibco 10378016 Experimental models: Cell lines hTERT-immortalized BJ fibroblasts Ludwig Institute, Uppsala RRID: CVCL_3653 Software and Live Cell Imaging:Article Title: Protocol for quantifying mitotic progression in adherent and suspension cells by live-cell imaging. Article Snippet: .. Fetal bovine serum (FBS) Saveen & Werner FB-1090–500 Trypsin + EDTA Gibco 3624-01 SPY-DNA Spirochrome SPY-505-DNA SPY-Tubulin Spirochrome SPY-555-tubulin Thymidine Sigma-Aldrich T1895 PBS without Ca2+ and Mg2+ SVA, Uppsala 992420/1000 Fibronectin (FN) Sigma-Aldrich F0895 Poly-L-lysine (PLL) Sigma-Aldrich P9155 Penicillin/Streptomycin Gibco 10378016 Experimental models: Cell lines hTERT-immortalized BJ fibroblasts Ludwig Institute, Uppsala RRID: CVCL_3653 Software and Control:Article Title: Cellular self-organization orchestrates ferroptosis propagation. Article Snippet: 30632780 Experimental models: Cell lines Human: hTERT-RPE1 cells ATCC CRL-4000; RRID: CVCL_4388 (Continued on next page) ll OPEN ACCESS e1 Cell 189, 1–17.e1–e12, December 24, 2026 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: HEK293T cells ATCC CRL-3216; RRID: CVCL_0063 Oligonucleotides Control siRNA Dharmacon Cat# D-001810-01 ON-TARGETplus SMARTpool siRNAs targeting SLC7A11/xCT Dharmacon Cat# L2-007612-01 ON-TARGETplus SMARTpool siRNAs targeting GPX4 Dharmacon Cat# L2-011676-01 Primer: SLC7A11/xCT Forward: 5′-ATGCAGTGGCAGTGACCTTT-3′ Genomics, Taiwan This paper Primer: SLC7A11/xCT Reverse: 5′-GGCAACAAAGATCGGAACTG-3′ Genomics, Taiwan This paper Primer: GPX4 Forward: 5′-GTGAGGCAAGACCGAAGTAAA-3′ Genomics, Taiwan This paper Primer: GPX4 Reverse: 5′-GAACTGGTTACACGGGAAGG-3′ Genomics, Taiwan This paper Primer: β-actin Forward: 5′-CACCATTGGCAATGAGCGGTTC-3′ Genomics, Taiwan This paper Primer: β-actin Reverse: 5′-AGGTCTTTGCGGATGTCCACGT-3′ Genomics, Taiwan This paper Recombinant DNA Plasmid: pCMV-VSV-G Addgene RRID: Addgene_8454 Plasmid: psPAX2 Addgene RRID: Addgene_12260 Plasmid: pLVX-mCherry-C1 Takara Bio Cat# 632561 Plasmid: pRRL-hCMV-SoNar This paper Zhao et al.45 Software and algorithms Recombinant:Article Title: Cellular self-organization orchestrates ferroptosis propagation. Article Snippet: 30632780 Experimental models: Cell lines Human: hTERT-RPE1 cells ATCC CRL-4000; RRID: CVCL_4388 (Continued on next page) ll OPEN ACCESS e1 Cell 189, 1–17.e1–e12, December 24, 2026 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: HEK293T cells ATCC CRL-3216; RRID: CVCL_0063 Oligonucleotides Control siRNA Dharmacon Cat# D-001810-01 ON-TARGETplus SMARTpool siRNAs targeting SLC7A11/xCT Dharmacon Cat# L2-007612-01 ON-TARGETplus SMARTpool siRNAs targeting GPX4 Dharmacon Cat# L2-011676-01 Primer: SLC7A11/xCT Forward: 5′-ATGCAGTGGCAGTGACCTTT-3′ Genomics, Taiwan This paper Primer: SLC7A11/xCT Reverse: 5′-GGCAACAAAGATCGGAACTG-3′ Genomics, Taiwan This paper Primer: GPX4 Forward: 5′-GTGAGGCAAGACCGAAGTAAA-3′ Genomics, Taiwan This paper Primer: GPX4 Reverse: 5′-GAACTGGTTACACGGGAAGG-3′ Genomics, Taiwan This paper Primer: β-actin Forward: 5′-CACCATTGGCAATGAGCGGTTC-3′ Genomics, Taiwan This paper Primer: β-actin Reverse: 5′-AGGTCTTTGCGGATGTCCACGT-3′ Genomics, Taiwan This paper Recombinant DNA Plasmid: pCMV-VSV-G Addgene RRID: Addgene_8454 Plasmid: psPAX2 Addgene RRID: Addgene_12260 Plasmid: pLVX-mCherry-C1 Takara Bio Cat# 632561 Plasmid: pRRL-hCMV-SoNar This paper Zhao et al.45 Software and algorithms Article Title: Incorporation of genome-bound cellular proteins into HIV-1 particles regulates viral infection. Article Snippet: .. AACAATA – N/A Primers for cloning, sgRNAs and knock out validation This paper See Table S6 Recombinant DNA pNL4-3 NIBSC – Center for AIDS Reagents Cat#2006 pNL4-3.Luc.R-E− NIBSC – Center for AIDS Reagents Cat#2128 pNL4.3-mCherry-T2A-Nef This paper N/A pNL4-3.R-E-mCherry-T2A-Nef Garcia-Moreno et al.62 N/A pNL4-3.R-E-mCherry-T2A-Nef-RevFlag-3xMyc This paper N/A pNL4-3.R-E-mCherry-T2A-Nef -Rev-Halo This paper N/A pNL4-3.R-E-mCherry-T2A-Nef-ΔRev This paper N/A pNL4.3-mCherry-T2A-gag Garcia-Moreno et al.62 N/A psPAX-2 Addgene Cat#12260 pHEF-VSVG NIH AIDS Reagent Program Cat#4693 pcR-Blunt vector Thermo Fisher Scientific Cat#K270020 pcR-Blunt-NL4.3-mCherry-T2A-Nef This paper N/A pcDNA6/TR plasmid Thermo Fisher Scientific Cat#V102520 pOG44 Thermo Fisher Scientific Cat#V600520 pcDNA5/FRT/TO-EGFP Castello et al.63 N/A pcDNA5/FRT/TO-EGFP-linker Garcia-Moreno et al.62 N/A MGC Human PURA Sequence-Verified cDNA (CloneId:5284976) Horizon Cat#MHS6278-202808724 BLADE plasmid Mageot et al.64 N/A Software and Article Title: 5-HT promotes bronchopulmonary dysplasia via TGM2-mediated serotonylation Article Snippet: .. 340 STAR METHODS 341 KEY RESOURCES TABLE 342 REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti- Serotonin Abcam Cat# Ab315150; RRID: AB_3697404 Anti-Transglutaminase 2 Cell Signaling Technology Cat# 3557; RRID: AB_2202883 Anti-Ki67 Rabbit pAb Servicebio Cat# GB111499 RRID: AB_2927572 Anti- β-Actin Proteintech Cat# 81115-1-RR; RRID: AB_2923704 Goat Anti-Rabbit IgG (H+L) Earthox Cat# E031620 RRID: AB_3065690 Goat Anti-Mouse IgG (H + L) HRP MultiSciences Cat# GAM0072 RRID: AB_3065690 Goat Anti-Rabbit IgG (H + L) HRP MultiSciences Cat# GAR007 RRID: AB_3073716 Biological samples Preterm infant blood samples Children’s Hospital of Nanjing Medical University Ethics No: 202110094-1 Chemicals, peptides, and recombinant proteins Jo urn al Pr e-p roo f 5-HT MCE Cat# HY-B1473A 5-PT MCE Cat# HY-156562 LB-533401 MCE Cat# HY-15849 ZED-1227 TargetMol Cat# T17289 DMEM/F12 Gibco Cat# 11320033 FBS Gibco Cat# 10099141C penicillin‒streptomycin Gibco Cat# 15070063 RIPA Beyotime Cat# P0013B Protease inhibitor cocktail and phosphatase inhibitor Beyotime Cat# P1046 SBE-β-CD MCE Cat# HY-17031 DMSO Beyotime Cat# ST038 PEG300 Beyotime Cat# Y268724 Tween 80 Beyotime Cat# ST2789 biotin-azide Thermo Fisher Cat# B10184 magnetic streptavidin beads MCE Cat# HY-K0208 Critical commercial assays Click-iT Cell Reaction Buffer Kit Thermo Fisher Cat# C33372 TGM2 Activity Assay Kit Novus Biologicals Cat# NBP1-37008 5-HT ELISA Kit Elabscience Cat# E-EL-0033 Cell Counting Kit-8 Beyotime Cat# C0038 Annexin V-FITC Apoptosis Detection Kit Beyotime Cat# C1062M TUNEL Cell Apoptosis Detection Kit Servicebio G1507-50T Experimental models: Cell lines MLE-12 ATCC BH-C465 Experimental models: Organisms/strains Lung of C57BL/6 wild-type mice Animal Center of Nanjing Medical University N/A Software and Plasmid Preparation:Article Title: Cellular self-organization orchestrates ferroptosis propagation. Article Snippet: 30632780 Experimental models: Cell lines Human: hTERT-RPE1 cells ATCC CRL-4000; RRID: CVCL_4388 (Continued on next page) ll OPEN ACCESS e1 Cell 189, 1–17.e1–e12, December 24, 2026 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: HEK293T cells ATCC CRL-3216; RRID: CVCL_0063 Oligonucleotides Control siRNA Dharmacon Cat# D-001810-01 ON-TARGETplus SMARTpool siRNAs targeting SLC7A11/xCT Dharmacon Cat# L2-007612-01 ON-TARGETplus SMARTpool siRNAs targeting GPX4 Dharmacon Cat# L2-011676-01 Primer: SLC7A11/xCT Forward: 5′-ATGCAGTGGCAGTGACCTTT-3′ Genomics, Taiwan This paper Primer: SLC7A11/xCT Reverse: 5′-GGCAACAAAGATCGGAACTG-3′ Genomics, Taiwan This paper Primer: GPX4 Forward: 5′-GTGAGGCAAGACCGAAGTAAA-3′ Genomics, Taiwan This paper Primer: GPX4 Reverse: 5′-GAACTGGTTACACGGGAAGG-3′ Genomics, Taiwan This paper Primer: β-actin Forward: 5′-CACCATTGGCAATGAGCGGTTC-3′ Genomics, Taiwan This paper Primer: β-actin Reverse: 5′-AGGTCTTTGCGGATGTCCACGT-3′ Genomics, Taiwan This paper Recombinant DNA Plasmid: pCMV-VSV-G Addgene RRID: Addgene_8454 Plasmid: psPAX2 Addgene RRID: Addgene_12260 Plasmid: pLVX-mCherry-C1 Takara Bio Cat# 632561 Plasmid: pRRL-hCMV-SoNar This paper Zhao et al.45 Software and algorithms Article Title: Incorporation of genome-bound cellular proteins into HIV-1 particles regulates viral infection. Article Snippet: .. AACAATA – N/A Primers for cloning, sgRNAs and knock out validation This paper See Table S6 Recombinant DNA pNL4-3 NIBSC – Center for AIDS Reagents Cat#2006 pNL4-3.Luc.R-E− NIBSC – Center for AIDS Reagents Cat#2128 pNL4.3-mCherry-T2A-Nef This paper N/A pNL4-3.R-E-mCherry-T2A-Nef Garcia-Moreno et al.62 N/A pNL4-3.R-E-mCherry-T2A-Nef-RevFlag-3xMyc This paper N/A pNL4-3.R-E-mCherry-T2A-Nef -Rev-Halo This paper N/A pNL4-3.R-E-mCherry-T2A-Nef-ΔRev This paper N/A pNL4.3-mCherry-T2A-gag Garcia-Moreno et al.62 N/A psPAX-2 Addgene Cat#12260 pHEF-VSVG NIH AIDS Reagent Program Cat#4693 pcR-Blunt vector Thermo Fisher Scientific Cat#K270020 pcR-Blunt-NL4.3-mCherry-T2A-Nef This paper N/A pcDNA6/TR plasmid Thermo Fisher Scientific Cat#V102520 pOG44 Thermo Fisher Scientific Cat#V600520 pcDNA5/FRT/TO-EGFP Castello et al.63 N/A pcDNA5/FRT/TO-EGFP-linker Garcia-Moreno et al.62 N/A MGC Human PURA Sequence-Verified cDNA (CloneId:5284976) Horizon Cat#MHS6278-202808724 BLADE plasmid Mageot et al.64 N/A Software and Maestro Software:Article Title: Cellular self-organization orchestrates ferroptosis propagation. Article Snippet: 30632780 Experimental models: Cell lines Human: hTERT-RPE1 cells ATCC CRL-4000; RRID: CVCL_4388 (Continued on next page) ll OPEN ACCESS e1 Cell 189, 1–17.e1–e12, December 24, 2026 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: HEK293T cells ATCC CRL-3216; RRID: CVCL_0063 Oligonucleotides Control siRNA Dharmacon Cat# D-001810-01 ON-TARGETplus SMARTpool siRNAs targeting SLC7A11/xCT Dharmacon Cat# L2-007612-01 ON-TARGETplus SMARTpool siRNAs targeting GPX4 Dharmacon Cat# L2-011676-01 Primer: SLC7A11/xCT Forward: 5′-ATGCAGTGGCAGTGACCTTT-3′ Genomics, Taiwan This paper Primer: SLC7A11/xCT Reverse: 5′-GGCAACAAAGATCGGAACTG-3′ Genomics, Taiwan This paper Primer: GPX4 Forward: 5′-GTGAGGCAAGACCGAAGTAAA-3′ Genomics, Taiwan This paper Primer: GPX4 Reverse: 5′-GAACTGGTTACACGGGAAGG-3′ Genomics, Taiwan This paper Primer: β-actin Forward: 5′-CACCATTGGCAATGAGCGGTTC-3′ Genomics, Taiwan This paper Primer: β-actin Reverse: 5′-AGGTCTTTGCGGATGTCCACGT-3′ Genomics, Taiwan This paper Recombinant DNA Plasmid: pCMV-VSV-G Addgene RRID: Addgene_8454 Plasmid: psPAX2 Addgene RRID: Addgene_12260 Plasmid: pLVX-mCherry-C1 Takara Bio Cat# 632561 Plasmid: pRRL-hCMV-SoNar This paper Zhao et al.45 Software and algorithms Cloning:Article Title: Incorporation of genome-bound cellular proteins into HIV-1 particles regulates viral infection. Article Snippet: .. AACAATA – N/A Primers for cloning, sgRNAs and knock out validation This paper See Table S6 Recombinant DNA pNL4-3 NIBSC – Center for AIDS Reagents Cat#2006 pNL4-3.Luc.R-E− NIBSC – Center for AIDS Reagents Cat#2128 pNL4.3-mCherry-T2A-Nef This paper N/A pNL4-3.R-E-mCherry-T2A-Nef Garcia-Moreno et al.62 N/A pNL4-3.R-E-mCherry-T2A-Nef-RevFlag-3xMyc This paper N/A pNL4-3.R-E-mCherry-T2A-Nef -Rev-Halo This paper N/A pNL4-3.R-E-mCherry-T2A-Nef-ΔRev This paper N/A pNL4.3-mCherry-T2A-gag Garcia-Moreno et al.62 N/A psPAX-2 Addgene Cat#12260 pHEF-VSVG NIH AIDS Reagent Program Cat#4693 pcR-Blunt vector Thermo Fisher Scientific Cat#K270020 pcR-Blunt-NL4.3-mCherry-T2A-Nef This paper N/A pcDNA6/TR plasmid Thermo Fisher Scientific Cat#V102520 pOG44 Thermo Fisher Scientific Cat#V600520 pcDNA5/FRT/TO-EGFP Castello et al.63 N/A pcDNA5/FRT/TO-EGFP-linker Garcia-Moreno et al.62 N/A MGC Human PURA Sequence-Verified cDNA (CloneId:5284976) Horizon Cat#MHS6278-202808724 BLADE plasmid Mageot et al.64 N/A Software and Knock-Out:Article Title: Incorporation of genome-bound cellular proteins into HIV-1 particles regulates viral infection. Article Snippet: .. AACAATA – N/A Primers for cloning, sgRNAs and knock out validation This paper See Table S6 Recombinant DNA pNL4-3 NIBSC – Center for AIDS Reagents Cat#2006 pNL4-3.Luc.R-E− NIBSC – Center for AIDS Reagents Cat#2128 pNL4.3-mCherry-T2A-Nef This paper N/A pNL4-3.R-E-mCherry-T2A-Nef Garcia-Moreno et al.62 N/A pNL4-3.R-E-mCherry-T2A-Nef-RevFlag-3xMyc This paper N/A pNL4-3.R-E-mCherry-T2A-Nef -Rev-Halo This paper N/A pNL4-3.R-E-mCherry-T2A-Nef-ΔRev This paper N/A pNL4.3-mCherry-T2A-gag Garcia-Moreno et al.62 N/A psPAX-2 Addgene Cat#12260 pHEF-VSVG NIH AIDS Reagent Program Cat#4693 pcR-Blunt vector Thermo Fisher Scientific Cat#K270020 pcR-Blunt-NL4.3-mCherry-T2A-Nef This paper N/A pcDNA6/TR plasmid Thermo Fisher Scientific Cat#V102520 pOG44 Thermo Fisher Scientific Cat#V600520 pcDNA5/FRT/TO-EGFP Castello et al.63 N/A pcDNA5/FRT/TO-EGFP-linker Garcia-Moreno et al.62 N/A MGC Human PURA Sequence-Verified cDNA (CloneId:5284976) Horizon Cat#MHS6278-202808724 BLADE plasmid Mageot et al.64 N/A Software and Biomarker Discovery:Article Title: Incorporation of genome-bound cellular proteins into HIV-1 particles regulates viral infection. Article Snippet: .. AACAATA – N/A Primers for cloning, sgRNAs and knock out validation This paper See Table S6 Recombinant DNA pNL4-3 NIBSC – Center for AIDS Reagents Cat#2006 pNL4-3.Luc.R-E− NIBSC – Center for AIDS Reagents Cat#2128 pNL4.3-mCherry-T2A-Nef This paper N/A pNL4-3.R-E-mCherry-T2A-Nef Garcia-Moreno et al.62 N/A pNL4-3.R-E-mCherry-T2A-Nef-RevFlag-3xMyc This paper N/A pNL4-3.R-E-mCherry-T2A-Nef -Rev-Halo This paper N/A pNL4-3.R-E-mCherry-T2A-Nef-ΔRev This paper N/A pNL4.3-mCherry-T2A-gag Garcia-Moreno et al.62 N/A psPAX-2 Addgene Cat#12260 pHEF-VSVG NIH AIDS Reagent Program Cat#4693 pcR-Blunt vector Thermo Fisher Scientific Cat#K270020 pcR-Blunt-NL4.3-mCherry-T2A-Nef This paper N/A pcDNA6/TR plasmid Thermo Fisher Scientific Cat#V102520 pOG44 Thermo Fisher Scientific Cat#V600520 pcDNA5/FRT/TO-EGFP Castello et al.63 N/A pcDNA5/FRT/TO-EGFP-linker Garcia-Moreno et al.62 N/A MGC Human PURA Sequence-Verified cDNA (CloneId:5284976) Horizon Cat#MHS6278-202808724 BLADE plasmid Mageot et al.64 N/A Software and Sequencing:Article Title: Incorporation of genome-bound cellular proteins into HIV-1 particles regulates viral infection. Article Snippet: .. AACAATA – N/A Primers for cloning, sgRNAs and knock out validation This paper See Table S6 Recombinant DNA pNL4-3 NIBSC – Center for AIDS Reagents Cat#2006 pNL4-3.Luc.R-E− NIBSC – Center for AIDS Reagents Cat#2128 pNL4.3-mCherry-T2A-Nef This paper N/A pNL4-3.R-E-mCherry-T2A-Nef Garcia-Moreno et al.62 N/A pNL4-3.R-E-mCherry-T2A-Nef-RevFlag-3xMyc This paper N/A pNL4-3.R-E-mCherry-T2A-Nef -Rev-Halo This paper N/A pNL4-3.R-E-mCherry-T2A-Nef-ΔRev This paper N/A pNL4.3-mCherry-T2A-gag Garcia-Moreno et al.62 N/A psPAX-2 Addgene Cat#12260 pHEF-VSVG NIH AIDS Reagent Program Cat#4693 pcR-Blunt vector Thermo Fisher Scientific Cat#K270020 pcR-Blunt-NL4.3-mCherry-T2A-Nef This paper N/A pcDNA6/TR plasmid Thermo Fisher Scientific Cat#V102520 pOG44 Thermo Fisher Scientific Cat#V600520 pcDNA5/FRT/TO-EGFP Castello et al.63 N/A pcDNA5/FRT/TO-EGFP-linker Garcia-Moreno et al.62 N/A MGC Human PURA Sequence-Verified cDNA (CloneId:5284976) Horizon Cat#MHS6278-202808724 BLADE plasmid Mageot et al.64 N/A Software and Article Title: An mTOR-Stat3-Stathmin pathway controls centrosome and microtubule dynamics for oocyte polarization. Article Snippet: KASP-PCR was performed on an Applied Biosystems StepOnePlus machine and following the manufacturer instructions, using the following SNP sequence: ATGCATGTTATAACAATCTGAAAACTGAAAATACTAAAACTGAAACTAATATTTAGCTATTGCTTGGGTATAACCTCTTACTCATC CTCCACAGGACA[TGGAGCA/-]GAAGATGAAAATGTTGGA GAATCTGCAGGATGATTTTGATTTCAACTACAAAACTCTTAAGAGTG CTGGA .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primer: Stathmin Forward: CAAGCCTGGAAC TCTCTGAAG; Reverse: CTGGATCTCCACCA AGGAAAG; Ddx4 Forward 5 ′ -GGTCGTGGA AAGATTGGCCTG-3 ′ ,Ddx4 Reverse 5 ′ -CAGCAGC CATTCTTTGAATATCTTC-3 ′ ; Beta actin Forward: 5 ′ -GGATTCGCTGGAGATGATGC; Reverse: 5 ′ – CGTGCTCGATGGGGTACTTC; HCR Probes: foxl2l; rec8a; dmc1 This paper; Molecular Instruments; Molecular Instruments; Molecular Instruments N/A; (accession #NM_001128810.1); (accession # XM_017359108.1); (#NM_001020782.1) KASP primer: stat3 stl27 Genotyping SNP primer sequence: ATGCATGTTATAACAATCTGAAAACTGAAAATACTAA AACTGAAACTAATATTTAGCTATTGCTTGGGTATAAC CTCTTACTCATCCTCCACAGGACA[TGGAGCA/-] GAAGATGAAAATGTTGGAGAATCTGCAGGATGATTTT GATTTCAACTACAAAACTCTTAAGAGTGCTGGA Kbioscience; This Paper N/A Software and Fluorescence In Situ Hybridization:Article Title: Incorporation of genome-bound cellular proteins into HIV-1 particles regulates viral infection. Article Snippet: .. AACAATA – N/A Primers for cloning, sgRNAs and knock out validation This paper See Table S6 Recombinant DNA pNL4-3 NIBSC – Center for AIDS Reagents Cat#2006 pNL4-3.Luc.R-E− NIBSC – Center for AIDS Reagents Cat#2128 pNL4.3-mCherry-T2A-Nef This paper N/A pNL4-3.R-E-mCherry-T2A-Nef Garcia-Moreno et al.62 N/A pNL4-3.R-E-mCherry-T2A-Nef-RevFlag-3xMyc This paper N/A pNL4-3.R-E-mCherry-T2A-Nef -Rev-Halo This paper N/A pNL4-3.R-E-mCherry-T2A-Nef-ΔRev This paper N/A pNL4.3-mCherry-T2A-gag Garcia-Moreno et al.62 N/A psPAX-2 Addgene Cat#12260 pHEF-VSVG NIH AIDS Reagent Program Cat#4693 pcR-Blunt vector Thermo Fisher Scientific Cat#K270020 pcR-Blunt-NL4.3-mCherry-T2A-Nef This paper N/A pcDNA6/TR plasmid Thermo Fisher Scientific Cat#V102520 pOG44 Thermo Fisher Scientific Cat#V600520 pcDNA5/FRT/TO-EGFP Castello et al.63 N/A pcDNA5/FRT/TO-EGFP-linker Garcia-Moreno et al.62 N/A MGC Human PURA Sequence-Verified cDNA (CloneId:5284976) Horizon Cat#MHS6278-202808724 BLADE plasmid Mageot et al.64 N/A Software and Imaging:Article Title: Ubiquitination-directed cytosolic DNA degradation governs cGAS-STING-mediated immune response to DNA damage. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER plenti-hygro-GFP-SPOP This paper N/A lentiCRISPR v2 Addgene Cat# 52961 pLVX-IRES-Neo Clontech Cat# 632181 psPAX2 Addgene Cat# 12260 pMD2.G Addgene Cat# 12259 Software and Light Microscopy:Article Title: Ubiquitination-directed cytosolic DNA degradation governs cGAS-STING-mediated immune response to DNA damage. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER plenti-hygro-GFP-SPOP This paper N/A lentiCRISPR v2 Addgene Cat# 52961 pLVX-IRES-Neo Clontech Cat# 632181 psPAX2 Addgene Cat# 12260 pMD2.G Addgene Cat# 12259 Software and Extraction:Article Title: Rad53 regulates RNase H1, which promotes DNA replication through sites of transcription-replication conflict. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PhosSTOP Roche Cat#04906845001 Proteinase K BioFroxx Cat#1151ML010 Q5 HotStart High-Fidelity DNA Polymerase New England Biolabs Cat#M0493L QX200TM ddPCRTM EvaGreen Supermix Bio-Rad Cat#186-4033 Random hexamers Thermo Fisher Scientific Cat#SO142 RNase A Thermo Fisher Scientific Cat#EN0531 RNase H New England Biolabs Cat#M0297L RNase T1 Thermo Fisher Scientific Cat#EN0542 RNaseOutTM Invitrogen Cat#10777019 SuperfrostTMPlus Adhesion Microscope Slides Epredia Cat#10149870 SuperScriptTM III Reverse Transcriptase Invitrogen Cat#18080044 SuperSignalTM West FEMTO Chemiluminescent Substrate Thermo Fisher Scientific Cat#34094 SuperSignalTM West Pico PLUS chemiluminescent substrate Thermo Fisher Scientific Cat#15669364 SYTOX Green nucleic acid stain Thermo Fisher Scientific Cat#S7020 Zymolyase® 20T (Arthrobacter luteus) Amsbio Cat#120491-1 Critical commercial assays Gentra Puregene Yeast/Bact. .. Extraction Kit B Qiagen Cat#158567 QIAquick PCR purification kit Qiagen Cat#28106 riboPool kit siTOOLs Cat#dp-P024-5 RNasre-Free DNase Set Qiagen Cat#79254 TruSeq stranded Total RNA LT Sample Prep Kit Illumina Cat#20020598 Deposited data RNA sequencing This study SRA: PRJNA1212884 Experimental models: Organisms/strains S. cerevisiae strains, S288C background derivatives This study See Table S1 Oligonucleotides Primers This study See Table S2 Software and Polymerase Chain Reaction:Article Title: Rad53 regulates RNase H1, which promotes DNA replication through sites of transcription-replication conflict. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PhosSTOP Roche Cat#04906845001 Proteinase K BioFroxx Cat#1151ML010 Q5 HotStart High-Fidelity DNA Polymerase New England Biolabs Cat#M0493L QX200TM ddPCRTM EvaGreen Supermix Bio-Rad Cat#186-4033 Random hexamers Thermo Fisher Scientific Cat#SO142 RNase A Thermo Fisher Scientific Cat#EN0531 RNase H New England Biolabs Cat#M0297L RNase T1 Thermo Fisher Scientific Cat#EN0542 RNaseOutTM Invitrogen Cat#10777019 SuperfrostTMPlus Adhesion Microscope Slides Epredia Cat#10149870 SuperScriptTM III Reverse Transcriptase Invitrogen Cat#18080044 SuperSignalTM West FEMTO Chemiluminescent Substrate Thermo Fisher Scientific Cat#34094 SuperSignalTM West Pico PLUS chemiluminescent substrate Thermo Fisher Scientific Cat#15669364 SYTOX Green nucleic acid stain Thermo Fisher Scientific Cat#S7020 Zymolyase® 20T (Arthrobacter luteus) Amsbio Cat#120491-1 Critical commercial assays Gentra Puregene Yeast/Bact. .. Extraction Kit B Qiagen Cat#158567 QIAquick PCR purification kit Qiagen Cat#28106 riboPool kit siTOOLs Cat#dp-P024-5 RNasre-Free DNase Set Qiagen Cat#79254 TruSeq stranded Total RNA LT Sample Prep Kit Illumina Cat#20020598 Deposited data RNA sequencing This study SRA: PRJNA1212884 Experimental models: Organisms/strains S. cerevisiae strains, S288C background derivatives This study See Table S1 Oligonucleotides Primers This study See Table S2 Software and Purification:Article Title: Rad53 regulates RNase H1, which promotes DNA replication through sites of transcription-replication conflict. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PhosSTOP Roche Cat#04906845001 Proteinase K BioFroxx Cat#1151ML010 Q5 HotStart High-Fidelity DNA Polymerase New England Biolabs Cat#M0493L QX200TM ddPCRTM EvaGreen Supermix Bio-Rad Cat#186-4033 Random hexamers Thermo Fisher Scientific Cat#SO142 RNase A Thermo Fisher Scientific Cat#EN0531 RNase H New England Biolabs Cat#M0297L RNase T1 Thermo Fisher Scientific Cat#EN0542 RNaseOutTM Invitrogen Cat#10777019 SuperfrostTMPlus Adhesion Microscope Slides Epredia Cat#10149870 SuperScriptTM III Reverse Transcriptase Invitrogen Cat#18080044 SuperSignalTM West FEMTO Chemiluminescent Substrate Thermo Fisher Scientific Cat#34094 SuperSignalTM West Pico PLUS chemiluminescent substrate Thermo Fisher Scientific Cat#15669364 SYTOX Green nucleic acid stain Thermo Fisher Scientific Cat#S7020 Zymolyase® 20T (Arthrobacter luteus) Amsbio Cat#120491-1 Critical commercial assays Gentra Puregene Yeast/Bact. .. Extraction Kit B Qiagen Cat#158567 QIAquick PCR purification kit Qiagen Cat#28106 riboPool kit siTOOLs Cat#dp-P024-5 RNasre-Free DNase Set Qiagen Cat#79254 TruSeq stranded Total RNA LT Sample Prep Kit Illumina Cat#20020598 Deposited data RNA sequencing This study SRA: PRJNA1212884 Experimental models: Organisms/strains S. cerevisiae strains, S288C background derivatives This study See Table S1 Oligonucleotides Primers This study See Table S2 Software and Sample Prep:Article Title: Rad53 regulates RNase H1, which promotes DNA replication through sites of transcription-replication conflict. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PhosSTOP Roche Cat#04906845001 Proteinase K BioFroxx Cat#1151ML010 Q5 HotStart High-Fidelity DNA Polymerase New England Biolabs Cat#M0493L QX200TM ddPCRTM EvaGreen Supermix Bio-Rad Cat#186-4033 Random hexamers Thermo Fisher Scientific Cat#SO142 RNase A Thermo Fisher Scientific Cat#EN0531 RNase H New England Biolabs Cat#M0297L RNase T1 Thermo Fisher Scientific Cat#EN0542 RNaseOutTM Invitrogen Cat#10777019 SuperfrostTMPlus Adhesion Microscope Slides Epredia Cat#10149870 SuperScriptTM III Reverse Transcriptase Invitrogen Cat#18080044 SuperSignalTM West FEMTO Chemiluminescent Substrate Thermo Fisher Scientific Cat#34094 SuperSignalTM West Pico PLUS chemiluminescent substrate Thermo Fisher Scientific Cat#15669364 SYTOX Green nucleic acid stain Thermo Fisher Scientific Cat#S7020 Zymolyase® 20T (Arthrobacter luteus) Amsbio Cat#120491-1 Critical commercial assays Gentra Puregene Yeast/Bact. .. Extraction Kit B Qiagen Cat#158567 QIAquick PCR purification kit Qiagen Cat#28106 riboPool kit siTOOLs Cat#dp-P024-5 RNasre-Free DNase Set Qiagen Cat#79254 TruSeq stranded Total RNA LT Sample Prep Kit Illumina Cat#20020598 Deposited data RNA sequencing This study SRA: PRJNA1212884 Experimental models: Organisms/strains S. cerevisiae strains, S288C background derivatives This study See Table S1 Oligonucleotides Primers This study See Table S2 Software and RNA Sequencing:Article Title: Rad53 regulates RNase H1, which promotes DNA replication through sites of transcription-replication conflict. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER PhosSTOP Roche Cat#04906845001 Proteinase K BioFroxx Cat#1151ML010 Q5 HotStart High-Fidelity DNA Polymerase New England Biolabs Cat#M0493L QX200TM ddPCRTM EvaGreen Supermix Bio-Rad Cat#186-4033 Random hexamers Thermo Fisher Scientific Cat#SO142 RNase A Thermo Fisher Scientific Cat#EN0531 RNase H New England Biolabs Cat#M0297L RNase T1 Thermo Fisher Scientific Cat#EN0542 RNaseOutTM Invitrogen Cat#10777019 SuperfrostTMPlus Adhesion Microscope Slides Epredia Cat#10149870 SuperScriptTM III Reverse Transcriptase Invitrogen Cat#18080044 SuperSignalTM West FEMTO Chemiluminescent Substrate Thermo Fisher Scientific Cat#34094 SuperSignalTM West Pico PLUS chemiluminescent substrate Thermo Fisher Scientific Cat#15669364 SYTOX Green nucleic acid stain Thermo Fisher Scientific Cat#S7020 Zymolyase® 20T (Arthrobacter luteus) Amsbio Cat#120491-1 Critical commercial assays Gentra Puregene Yeast/Bact. .. Extraction Kit B Qiagen Cat#158567 QIAquick PCR purification kit Qiagen Cat#28106 riboPool kit siTOOLs Cat#dp-P024-5 RNasre-Free DNase Set Qiagen Cat#79254 TruSeq stranded Total RNA LT Sample Prep Kit Illumina Cat#20020598 Deposited data RNA sequencing This study SRA: PRJNA1212884 Experimental models: Organisms/strains S. cerevisiae strains, S288C background derivatives This study See Table S1 Oligonucleotides Primers This study See Table S2 Software and other:Article Title: GPR75 in glutamatergic neurons regulates body weight. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Gpr75 Novus Biologicals Cat# NBP1-59406; RRID: AB_11037221 Opal570 Akoya Biosciences Cat# FP1488001KT; RRID: AB_3739820 Opal520 Akoya Biosciences Cat# FP1487001KT; RRID: AB_3739821 Chemicals, peptides, and recombinant proteins Alt-R TM S.p. dCas9 Protein V3 Integrated DNA Technologies Cat#1081067 Gpr75 (NINQMPIPSA(R10), AQUA QuantProHeavy ThermoFisher N/A Critical commercial assays Multiplex fluorescent kit Bio-techne Cat# 323110 Aurum TM Total RNA Fatty and Protease Inhibitor:Article Title: 5-HT promotes bronchopulmonary dysplasia via TGM2-mediated serotonylation Article Snippet: .. 340 STAR METHODS 341 KEY RESOURCES TABLE 342 REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti- Serotonin Abcam Cat# Ab315150; RRID: AB_3697404 Anti-Transglutaminase 2 Cell Signaling Technology Cat# 3557; RRID: AB_2202883 Anti-Ki67 Rabbit pAb Servicebio Cat# GB111499 RRID: AB_2927572 Anti- β-Actin Proteintech Cat# 81115-1-RR; RRID: AB_2923704 Goat Anti-Rabbit IgG (H+L) Earthox Cat# E031620 RRID: AB_3065690 Goat Anti-Mouse IgG (H + L) HRP MultiSciences Cat# GAM0072 RRID: AB_3065690 Goat Anti-Rabbit IgG (H + L) HRP MultiSciences Cat# GAR007 RRID: AB_3073716 Biological samples Preterm infant blood samples Children’s Hospital of Nanjing Medical University Ethics No: 202110094-1 Chemicals, peptides, and recombinant proteins Jo urn al Pr e-p roo f 5-HT MCE Cat# HY-B1473A 5-PT MCE Cat# HY-156562 LB-533401 MCE Cat# HY-15849 ZED-1227 TargetMol Cat# T17289 DMEM/F12 Gibco Cat# 11320033 FBS Gibco Cat# 10099141C penicillin‒streptomycin Gibco Cat# 15070063 RIPA Beyotime Cat# P0013B Protease inhibitor cocktail and phosphatase inhibitor Beyotime Cat# P1046 SBE-β-CD MCE Cat# HY-17031 DMSO Beyotime Cat# ST038 PEG300 Beyotime Cat# Y268724 Tween 80 Beyotime Cat# ST2789 biotin-azide Thermo Fisher Cat# B10184 magnetic streptavidin beads MCE Cat# HY-K0208 Critical commercial assays Click-iT Cell Reaction Buffer Kit Thermo Fisher Cat# C33372 TGM2 Activity Assay Kit Novus Biologicals Cat# NBP1-37008 5-HT ELISA Kit Elabscience Cat# E-EL-0033 Cell Counting Kit-8 Beyotime Cat# C0038 Annexin V-FITC Apoptosis Detection Kit Beyotime Cat# C1062M TUNEL Cell Apoptosis Detection Kit Servicebio G1507-50T Experimental models: Cell lines MLE-12 ATCC BH-C465 Experimental models: Organisms/strains Lung of C57BL/6 wild-type mice Animal Center of Nanjing Medical University N/A Software and Activity Assay:Article Title: 5-HT promotes bronchopulmonary dysplasia via TGM2-mediated serotonylation Article Snippet: .. 340 STAR METHODS 341 KEY RESOURCES TABLE 342 REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti- Serotonin Abcam Cat# Ab315150; RRID: AB_3697404 Anti-Transglutaminase 2 Cell Signaling Technology Cat# 3557; RRID: AB_2202883 Anti-Ki67 Rabbit pAb Servicebio Cat# GB111499 RRID: AB_2927572 Anti- β-Actin Proteintech Cat# 81115-1-RR; RRID: AB_2923704 Goat Anti-Rabbit IgG (H+L) Earthox Cat# E031620 RRID: AB_3065690 Goat Anti-Mouse IgG (H + L) HRP MultiSciences Cat# GAM0072 RRID: AB_3065690 Goat Anti-Rabbit IgG (H + L) HRP MultiSciences Cat# GAR007 RRID: AB_3073716 Biological samples Preterm infant blood samples Children’s Hospital of Nanjing Medical University Ethics No: 202110094-1 Chemicals, peptides, and recombinant proteins Jo urn al Pr e-p roo f 5-HT MCE Cat# HY-B1473A 5-PT MCE Cat# HY-156562 LB-533401 MCE Cat# HY-15849 ZED-1227 TargetMol Cat# T17289 DMEM/F12 Gibco Cat# 11320033 FBS Gibco Cat# 10099141C penicillin‒streptomycin Gibco Cat# 15070063 RIPA Beyotime Cat# P0013B Protease inhibitor cocktail and phosphatase inhibitor Beyotime Cat# P1046 SBE-β-CD MCE Cat# HY-17031 DMSO Beyotime Cat# ST038 PEG300 Beyotime Cat# Y268724 Tween 80 Beyotime Cat# ST2789 biotin-azide Thermo Fisher Cat# B10184 magnetic streptavidin beads MCE Cat# HY-K0208 Critical commercial assays Click-iT Cell Reaction Buffer Kit Thermo Fisher Cat# C33372 TGM2 Activity Assay Kit Novus Biologicals Cat# NBP1-37008 5-HT ELISA Kit Elabscience Cat# E-EL-0033 Cell Counting Kit-8 Beyotime Cat# C0038 Annexin V-FITC Apoptosis Detection Kit Beyotime Cat# C1062M TUNEL Cell Apoptosis Detection Kit Servicebio G1507-50T Experimental models: Cell lines MLE-12 ATCC BH-C465 Experimental models: Organisms/strains Lung of C57BL/6 wild-type mice Animal Center of Nanjing Medical University N/A Software and Enzyme-linked Immunosorbent Assay:Article Title: 5-HT promotes bronchopulmonary dysplasia via TGM2-mediated serotonylation Article Snippet: .. 340 STAR METHODS 341 KEY RESOURCES TABLE 342 REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti- Serotonin Abcam Cat# Ab315150; RRID: AB_3697404 Anti-Transglutaminase 2 Cell Signaling Technology Cat# 3557; RRID: AB_2202883 Anti-Ki67 Rabbit pAb Servicebio Cat# GB111499 RRID: AB_2927572 Anti- β-Actin Proteintech Cat# 81115-1-RR; RRID: AB_2923704 Goat Anti-Rabbit IgG (H+L) Earthox Cat# E031620 RRID: AB_3065690 Goat Anti-Mouse IgG (H + L) HRP MultiSciences Cat# GAM0072 RRID: AB_3065690 Goat Anti-Rabbit IgG (H + L) HRP MultiSciences Cat# GAR007 RRID: AB_3073716 Biological samples Preterm infant blood samples Children’s Hospital of Nanjing Medical University Ethics No: 202110094-1 Chemicals, peptides, and recombinant proteins Jo urn al Pr e-p roo f 5-HT MCE Cat# HY-B1473A 5-PT MCE Cat# HY-156562 LB-533401 MCE Cat# HY-15849 ZED-1227 TargetMol Cat# T17289 DMEM/F12 Gibco Cat# 11320033 FBS Gibco Cat# 10099141C penicillin‒streptomycin Gibco Cat# 15070063 RIPA Beyotime Cat# P0013B Protease inhibitor cocktail and phosphatase inhibitor Beyotime Cat# P1046 SBE-β-CD MCE Cat# HY-17031 DMSO Beyotime Cat# ST038 PEG300 Beyotime Cat# Y268724 Tween 80 Beyotime Cat# ST2789 biotin-azide Thermo Fisher Cat# B10184 magnetic streptavidin beads MCE Cat# HY-K0208 Critical commercial assays Click-iT Cell Reaction Buffer Kit Thermo Fisher Cat# C33372 TGM2 Activity Assay Kit Novus Biologicals Cat# NBP1-37008 5-HT ELISA Kit Elabscience Cat# E-EL-0033 Cell Counting Kit-8 Beyotime Cat# C0038 Annexin V-FITC Apoptosis Detection Kit Beyotime Cat# C1062M TUNEL Cell Apoptosis Detection Kit Servicebio G1507-50T Experimental models: Cell lines MLE-12 ATCC BH-C465 Experimental models: Organisms/strains Lung of C57BL/6 wild-type mice Animal Center of Nanjing Medical University N/A Software and CCK-8 Assay:Article Title: 5-HT promotes bronchopulmonary dysplasia via TGM2-mediated serotonylation Article Snippet: .. 340 STAR METHODS 341 KEY RESOURCES TABLE 342 REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti- Serotonin Abcam Cat# Ab315150; RRID: AB_3697404 Anti-Transglutaminase 2 Cell Signaling Technology Cat# 3557; RRID: AB_2202883 Anti-Ki67 Rabbit pAb Servicebio Cat# GB111499 RRID: AB_2927572 Anti- β-Actin Proteintech Cat# 81115-1-RR; RRID: AB_2923704 Goat Anti-Rabbit IgG (H+L) Earthox Cat# E031620 RRID: AB_3065690 Goat Anti-Mouse IgG (H + L) HRP MultiSciences Cat# GAM0072 RRID: AB_3065690 Goat Anti-Rabbit IgG (H + L) HRP MultiSciences Cat# GAR007 RRID: AB_3073716 Biological samples Preterm infant blood samples Children’s Hospital of Nanjing Medical University Ethics No: 202110094-1 Chemicals, peptides, and recombinant proteins Jo urn al Pr e-p roo f 5-HT MCE Cat# HY-B1473A 5-PT MCE Cat# HY-156562 LB-533401 MCE Cat# HY-15849 ZED-1227 TargetMol Cat# T17289 DMEM/F12 Gibco Cat# 11320033 FBS Gibco Cat# 10099141C penicillin‒streptomycin Gibco Cat# 15070063 RIPA Beyotime Cat# P0013B Protease inhibitor cocktail and phosphatase inhibitor Beyotime Cat# P1046 SBE-β-CD MCE Cat# HY-17031 DMSO Beyotime Cat# ST038 PEG300 Beyotime Cat# Y268724 Tween 80 Beyotime Cat# ST2789 biotin-azide Thermo Fisher Cat# B10184 magnetic streptavidin beads MCE Cat# HY-K0208 Critical commercial assays Click-iT Cell Reaction Buffer Kit Thermo Fisher Cat# C33372 TGM2 Activity Assay Kit Novus Biologicals Cat# NBP1-37008 5-HT ELISA Kit Elabscience Cat# E-EL-0033 Cell Counting Kit-8 Beyotime Cat# C0038 Annexin V-FITC Apoptosis Detection Kit Beyotime Cat# C1062M TUNEL Cell Apoptosis Detection Kit Servicebio G1507-50T Experimental models: Cell lines MLE-12 ATCC BH-C465 Experimental models: Organisms/strains Lung of C57BL/6 wild-type mice Animal Center of Nanjing Medical University N/A Software and TUNEL Assay:Article Title: 5-HT promotes bronchopulmonary dysplasia via TGM2-mediated serotonylation Article Snippet: .. 340 STAR METHODS 341 KEY RESOURCES TABLE 342 REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti- Serotonin Abcam Cat# Ab315150; RRID: AB_3697404 Anti-Transglutaminase 2 Cell Signaling Technology Cat# 3557; RRID: AB_2202883 Anti-Ki67 Rabbit pAb Servicebio Cat# GB111499 RRID: AB_2927572 Anti- β-Actin Proteintech Cat# 81115-1-RR; RRID: AB_2923704 Goat Anti-Rabbit IgG (H+L) Earthox Cat# E031620 RRID: AB_3065690 Goat Anti-Mouse IgG (H + L) HRP MultiSciences Cat# GAM0072 RRID: AB_3065690 Goat Anti-Rabbit IgG (H + L) HRP MultiSciences Cat# GAR007 RRID: AB_3073716 Biological samples Preterm infant blood samples Children’s Hospital of Nanjing Medical University Ethics No: 202110094-1 Chemicals, peptides, and recombinant proteins Jo urn al Pr e-p roo f 5-HT MCE Cat# HY-B1473A 5-PT MCE Cat# HY-156562 LB-533401 MCE Cat# HY-15849 ZED-1227 TargetMol Cat# T17289 DMEM/F12 Gibco Cat# 11320033 FBS Gibco Cat# 10099141C penicillin‒streptomycin Gibco Cat# 15070063 RIPA Beyotime Cat# P0013B Protease inhibitor cocktail and phosphatase inhibitor Beyotime Cat# P1046 SBE-β-CD MCE Cat# HY-17031 DMSO Beyotime Cat# ST038 PEG300 Beyotime Cat# Y268724 Tween 80 Beyotime Cat# ST2789 biotin-azide Thermo Fisher Cat# B10184 magnetic streptavidin beads MCE Cat# HY-K0208 Critical commercial assays Click-iT Cell Reaction Buffer Kit Thermo Fisher Cat# C33372 TGM2 Activity Assay Kit Novus Biologicals Cat# NBP1-37008 5-HT ELISA Kit Elabscience Cat# E-EL-0033 Cell Counting Kit-8 Beyotime Cat# C0038 Annexin V-FITC Apoptosis Detection Kit Beyotime Cat# C1062M TUNEL Cell Apoptosis Detection Kit Servicebio G1507-50T Experimental models: Cell lines MLE-12 ATCC BH-C465 Experimental models: Organisms/strains Lung of C57BL/6 wild-type mice Animal Center of Nanjing Medical University N/A Software and |